skip to Main Content
The smarter way
to do assignments.

Please note that this is just a preview of a school assignment posted on our website by one of our clients. If you need assistance with this question too, please click on the Order button at the bottom of the page to get started.

PART 1The line through the base pairs represents the sites where bonds will break if the restriction enzyme EcoRI recognizes the site GAATTC. The following analysis questions refer to how a piece of DNA would be affected if a restriction endonuclease were to “cut” the DNA molecule in the manner shown above. (Hint: each row is not considered a different piece)How many pieces of DNA would result from this cut? (1 pt) ___________
Write the base sequence of the DNA fragments on both the left and right side of the cut. (2 pts)
Left: Right: 1.Identify the flanking sequences and the number of repeat units [GAAT] in the following STR, known as TPOX, on human chromosome 2:CCACACAGGTAATGAATGAATGAATGAATGAATGCCTAAGTGCC a.partial flanking sequences (2 pt): b.number of repeat units (1 pt):2.Write out the STR shown above using genetic shorthand (1 pt) PART 2Crime Report: A thief has stolen a priceless collection of jewels a jewelry store. Forensic technicians obtained a blood sample left behind by the thief. DNA has been isolated.Can DNA demand a verdict? Read through the following page: https://learn.genetics.utah.edu/content/science/forensics/Once you have read some background, head to https://learn.genetics.utah.edu/content/labs/pcr/ to perform a virtual PCR.1.What is PCR accomplishing? Why do we first need to perform PCR? (4 pts)2.What are the steps of PCR? (2 pts)Now that the DNA has been isolated and the PCR amplified for some of the standard STR loci, let’s run a gel electrophoresis: https://learn.genetics.utah.edu/content/labs/gel/3.Why would you run gel electrophoresis on a DNA sample? What does gel electrophoresis do? Explain the process in your own words. (4 pts)4.Where would you expect to see smaller fragments (in relation to the wells you are placing the DNA samples in)? Larger fragments? (2 pts)5.In Step 5 (staining the gel and analyzing the results), what are the estimates for the base pairs in the DNA Sample (from largest to smallest): (3 pts)6.A piece of DNA is cut into four fragments as shown in the diagram below and gel electrophoresis is performed. Using the information given above, draw in the gel below how you think the fragments might separate. Label each fragment with its corresponding letter. (4 pts) DNA Sample The diagram below represents a piece of DNA cut with a particular restriction enzyme at each of the sites labeled by arrows. The numbers represent the number of base pairs in each fragment.7.How many pieces of DNA were produced from this fragment? (1 pt)On the gel diagram below, show how you believe these fragments will sort out during electrophoresis. The two fragments with no length indicated will be too small to be visualized on the gel. Label each fragment with its correct number of base pairs. (6 pts)
9.In the hypothetical gel below, which DNA samples were cut into the same number and size of fragments? (CS= Crime scene, S= Suspect  Suspects 1-3) (2 pts)PART 3Interpreting the Output of Gel ElectrophoresisThe police have come up with seven possible suspects for the crime at the jewelry store. All have a criminal record and lucky for the police, they have previously submitted samples of their DNA to the CODIS database. After a couple of days of processing the blood sample, extracting DNA, and performing a digest with enzymes EcoRI and PstI, you have loaded all your samples on to an agarose gel for electrophoresis.You have loaded: M = molecular weight marker (ladder) 1 = Crime Scene sample 2 = Suspect 1 3 = Suspect 2 4 = Suspect 3 5 = Suspect 4 6 = Suspect 5 7 = Suspect 6 8 = Suspect 7A molecular weight marker (M) is a set of DNA fragments of known sizes. DNA fragments in a gel electrophoresis image can be measured by comparing to the fragments of known size in the marker. The unit of measure used for sizing DNA is the kilobase (kb), equivalent to 1000 base pairs.You ran your gel and have prepared the following image from your gel:Use the image to fill out the table: [4 points] SamplesNumber of fragmentsSizes of fragments Crime sceneSuspect 1Suspect 2Suspect 3Suspect 4Suspect 5Suspect 6Suspect 7Why is there more than one band of DNA for each of the samples? [2 points] Why does the number of bands vary between the samples? [2 points] Compare the fragment sizes of the suspects and the crime scene. Is there a single suspect that matches the crime scene? How certain are you of the match (keep in mind the possible consequences to the suspect if you are not certain)? [2 points]

GET HELP WITH THIS ASSIGNMENT TODAY

Clicking on this button will take you to our custom assignment page. Here you can fill out all the additional details for this particular paper (grading rubric, academic style, number of sources etc), after which your paper will get assigned to a course-specific writer. If you have any issues/concerns, please don’t hesitate to contact our live support team or email us right away.

How It Works        |        About Us       |       Contact Us

© 2018 | Intelli Essays Homework Service®